nf-core/viralrecon report
A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.
Report generated on 2024-08-21, 13:14 CEST based on data in:
/Users/vlad/git/website/public/examples/jupyter/data/assembly/Users/vlad/git/website/public/examples/jupyter/data/kraken2/Users/vlad/git/website/public/examples/jupyter/data/variants/Users/vlad/git/website/public/examples/jupyter/data/fastqc
nf-core/viralrecon summary
De novo assembly metrics
Summary of input reads, trimmed reads, and non-host reads. Generated by the nf-core/viralrecon pipeline
| Sample Name | # Input reads | % Non-host reads (Kraken 2) |
|---|---|---|
| SAMPLE1_PE | 55442 | 100.0 |
| SAMPLE2_PE | 42962 | 99.8 |
| SAMPLE3_SE | 49202 | 99.9 |
fastp
0.23.2
All-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).URL: https://github.com/OpenGene/fastpDOI: 10.1093/bioinformatics/bty560
Fastp goes through fastq files in a folder and perform a series of quality control and filtering. Quality control and reporting are displayed both before and after filtering, allowing for a clear depiction of the consequences of the filtering process. Notably, the latter can be conducted on a variety of parameters including quality scores, length, as well as the presence of adapters, polyG, or polyX tailing.Filtered Reads
Filtering statistics of sampled reads.
Insert Sizes
Insert size estimation of sampled reads.
Sequence Quality
Average sequencing quality over each base of all reads.
GC Content
Average GC content over each base of all reads.
N content
Average N content over each base of all reads.
Bcftools
1.16
Utilities for variant calling and manipulating VCFs and BCFs.URL: https://samtools.github.io/bcftoolsDOI: 10.1093/gigascience/giab008
Variant Substitution Types
Variant Quality
Indel Distribution
Variant depths
Read depth support distribution for called variants
Bowtie 2 / HiSAT2
Results from both Bowtie 2 and HISAT2, tools for aligning reads against a reference genome.URL: http://bowtie-bio.sourceforge.net/bowtie2; https://ccb.jhu.edu/software/hisat2DOI: 10.1038/nmeth.1923; 10.1038/nmeth.3317; 10.1038/s41587-019-0201-4
Single-end alignments
This plot shows the number of reads aligning to the reference in different ways.
There are 3 possible types of alignment:
- SE mapped uniquely: Read has only one occurence in the reference genome.
- SE multimapped: Read has multiple occurence.
- SE not aligned: Read has no occurence.
Paired-end alignments
This plot shows the number of reads aligning to the reference in different ways.
There are 6 possible types of alignment:
- PE mapped uniquely: Pair has only one occurence in the reference genome.
- PE mapped discordantly uniquely: Pair has only one occurence but not in proper pair.
- PE one mate mapped uniquely: One read of a pair has one occurence.
- PE multimapped: Pair has multiple occurence.
- PE one mate multimapped: One read of a pair has multiple occurence.
- PE neither mate aligned: Pair has no occurence.
Cutadapt
4.2
Finds and removes adapter sequences, primers, poly-A tails, and other types of unwanted sequences.URL: https://cutadapt.readthedocs.ioDOI: 10.14806/ej.17.1.200
Filtered Reads
This plot shows the number of reads (SE) / pairs (PE) removed by Cutadapt.
Trimmed Sequence Lengths
This plot shows the number of reads with certain lengths of adapter trimmed.
Obs/Exp shows the raw counts divided by the number expected due to sequencing errors. A defined peak may be related to adapter length.
See the cutadapt documentation for more information on how these numbers are generated.
FastQC
0.11.9
Quality control tool for high throughput sequencing data.URL: http://www.bioinformatics.babraham.ac.uk/projects/fastqc
Sequence Counts
Sequence counts for each sample. Duplicate read counts are an estimate only.
This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).
You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:
Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.
The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.
Sequence Quality Histograms
The mean quality value across each base position in the read.
To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).
Taken from the FastQC help:
The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.
Per Sequence Quality Scores
The number of reads with average quality scores. Shows if a subset of reads has poor quality.
From the FastQC help:
The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.
Per Base Sequence Content
The proportion of each base position for which each of the four normal DNA bases has been called.
To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.
To see the data as a line plot, as in the original FastQC graph, click on a sample track.
From the FastQC help:
Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.
In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.
It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.
Rollover for sample name
Per Sequence GC Content
The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.
From the FastQC help:
This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.
In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.
An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.
Per Base N Content
The percentage of base calls at each position for which an N was called.
From the FastQC help:
If a sequencer is unable to make a base call with sufficient confidence then it will
normally substitute an N rather than a conventional base call. This graph shows the
percentage of base calls at each position for which an N was called.
It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.
Sequence Length Distribution
The distribution of fragment sizes (read lengths) found. See the FastQC help
Sequence Duplication Levels
The relative level of duplication found for every sequence.
From the FastQC Help:
In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (e.g. PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.
Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.
The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.
In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.
Overrepresented sequences by sample
The total amount of overrepresented sequences found in each library.
FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.
Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.
From the FastQC Help:
A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.
FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.
Top overrepresented sequences
Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.
| Overrepresented sequence | Samples | Occurrences | % of all reads |
|---|---|---|---|
| ACTACCGAAGTTGTAGGAGACATTATACTTAAACCAGCAAATAATAGTTT | 7 | 3914 | 2.2167% |
| CCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAA | 7 | 3210 | 1.8180% |
| ACAGTATTCTTTGCTATAGTAGTCGGCATAGATGCTTTAATTCTAGAATT | 7 | 3369 | 1.9080% |
| ACTAGGTTCCATTGTTCAAGGAGCTTTTTAAGCTCTTCAACGGTAATAGT | 7 | 3031 | 1.7166% |
| CGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTATG | 7 | 2907 | 1.6464% |
| TGAAATGGTGAATTGCCCTCGTATGTTCCAGAAGAGCAAGGTTCTTTTAA | 7 | 2693 | 1.5252% |
| AGCCTCATAAAACTCAGGTTCCCAATACCTTGAAGTGTTATCATTAGTAA | 7 | 2565 | 1.4527% |
| TGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTATGTGTACA | 7 | 2409 | 1.3643% |
| CTTTTCTCCAAGCAGGGTTACGTGTAAGGAATTCTCTTACCACGCCTATT | 7 | 2451 | 1.3881% |
| CATCCAGATTCTGCCACTCTTGTTAGTGACATTGACATCACTTTCTTAAA | 7 | 2333 | 1.3213% |
| GGTGTATACTGCTGCCGTGAACATGAGCATGAAATTGCTTGGTACACGGA | 7 | 2360 | 1.3366% |
| AGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCATGAATTTT | 7 | 2350 | 1.3309% |
| CAGCCCCTATTAAACAGCCTGCACGTGTTTGAAAAACATTAGAACCTGTA | 7 | 2443 | 1.3836% |
| GTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTCTCAAC | 7 | 2279 | 1.2907% |
| CACAAGTAGTGGCACCTTCTTTAGTCAAATTCTCAGTGCCACAAAATTCG | 7 | 2282 | 1.2924% |
| AGTGAAATTGGGCCTCATAGCACATTGGTAAACACCAGATGGTGAACCAT | 7 | 2029 | 1.1491% |
| AGTTTCCACACAGACAGGCATTAATTTGCGTGTTTCTTCTGCATGTGCAA | 7 | 2103 | 1.1910% |
| AAGGTGTCTGCAATTCATAGCTCTTTTCAGAACGTTCCGTGTACCAAGCA | 7 | 2126 | 1.2040% |
| AGGAATTACTTGTGTATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGT | 7 | 1935 | 1.0959% |
| CGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCAT | 7 | 1905 | 1.0789% |
Adapter Content
The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.
Note that only samples with ≥ 0.1% adapter contamination are shown.
There may be several lines per sample, as one is shown for each adapter detected in the file.
From the FastQC Help:
The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.
Status Checks
Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).
FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).
It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.
Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.
In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.
Kraken
Taxonomic classification tool that uses exact k-mer matches to find the lowest common ancestor (LCA) of a given sequence.URL: https://ccb.jhu.edu/software/krakenDOI: 10.1186/gb-2014-15-3-r46
Top taxa
The number of reads falling into the top 5 taxa across different ranks.
To make this plot, the percentage of each sample assigned to a given taxa is summed across all samples. The counts for these top 5 taxa are then plotted for each of the 9 different taxa ranks. The unclassified count is always shown across all taxa ranks.
The total number of reads is approximated by dividing the number of unclassified reads by the percentage of
the library that they account for.
Note that this is only an approximation, and that kraken percentages don't always add to exactly 100%.
The category "Other" shows the difference between the above total read count and the sum of the read counts in the top 5 taxa shown + unclassified. This should cover all taxa not in the top 5, +/- any rounding errors.
Note that any taxon that does not exactly fit a taxon rank (eg. - or G2) is ignored.
Nextclade
Viral genome alignment, clade assignment, mutation calling, and quality checks.URL: https://github.com/nextstrain/nextcladeDOI: 10.21105/joss.03773
Nextclade assigns input sequences to SARS-Cov-2 clades based on differences between the input sequences and [Nextstrain](https://nextstrain.org/) reference sequences. In addition, it judges the validity of the samples by performing several quality control checks on the input sequences.Run table
| Sample Name | Clade | QC Overall Status | QC Missing Data Status | QC Mixed Sites Status |
|---|---|---|---|---|
| SAMPLE1_PE | 20A | good | good | good |
| SAMPLE2_PE | 19B | bad | bad | good |
| SAMPLE3_SE | 19A | good | good | good |
Pangolin
4.2
Scorpio:
0.3.17
Constellations:
v0.1.10
Uses variant calls to assign SARS-CoV-2 genome sequences to global lineages.URL: https://github.com/cov-lineages/pangolinDOI: 10.1093/ve/veab064
Implements the dynamic nomenclature of SARS-CoV-2 lineages, known as the Pango nomenclature. It allows a user to assign a SARS-CoV-2 genome sequence the most likely lineage (Pango lineage) to SARS-CoV-2 query sequences.Run table
Statistics gathered from the input pangolin files. Hover over the column headers for descriptions and click Help for more in-depth documentation.
This table shows some of the metrics parsed by Pangolin. Hover over the column headers to see a description of the contents. Longer help text for certain columns is shown below:
- Conflict
- In the pangoLEARN decision tree model, a given sequence gets assigned to the most likely category based on known diversity.
If a sequence can fit into more than one category, the conflict score will be greater than
0and reflect the number of categories the sequence could fit into. If the conflict score is0, this means that within the current decision tree there is only one category that the sequence could be assigned to.
- In the pangoLEARN decision tree model, a given sequence gets assigned to the most likely category based on known diversity.
If a sequence can fit into more than one category, the conflict score will be greater than
- Ambiguity score
- This score is a function of the quantity of missing data in a sequence.
It represents the proportion of relevant sites in a sequence which were imputed to the reference values.
A score of
1indicates that no sites were imputed, while a score of0indicates that more sites were imputed than were not imputed. This score only includes sites which are used by the decision tree to classify a sequence.
- This score is a function of the quantity of missing data in a sequence.
It represents the proportion of relevant sites in a sequence which were imputed to the reference values.
A score of
- Scorpio conflict
- The conflict score is the proportion of defining variants which have the reference allele in the sequence. Ambiguous/other non-ref/alt bases at each of the variant positions contribute only to the denominators of these scores.
- Note
- If any conflicts from the decision tree, this field will output the alternative assignments. If the sequence failed QC this field will describe why. If the sequence met the SNP thresholds for scorpio to call a constellation, it’ll describe the exact SNP counts of Alt, Ref and Amb (Alternative, reference and ambiguous) alleles for that call.
| Sample Name | Lineage | Conflict | Ambiguity | S call | S support | S conflict | QC Status | QC Note | Note |
|---|---|---|---|---|---|---|---|---|---|
| SAMPLE1_PE | B.1 | 0.0 | Pass | Ambiguous content: 3% | Usher placements: B.1(1/1) | ||||
| SAMPLE2_PE | A.2 | 0.0 | Pass | Ambiguous content: 11% | Usher placements: A.2(2/2) | ||||
| SAMPLE3_SE | B | 0.3 | Pass | Ambiguous content: 4% | Usher placements: B(2/3) B.1(1/3) |
Picard
Tools for manipulating high-throughput sequencing data.URL: http://broadinstitute.github.io/picard
Alignment Summary
Please note that Picard's read counts are divided by two for paired-end data. Total bases (including unaligned) is not provided.
Mean read length
The mean read length of the set of reads examined.
Base Distribution
Plot shows the distribution of bases by cycle.
Insert Size
Plot shows the number of reads at a given insert size. Reads with different orientations are summed.
Mean Base Quality by Cycle
Plot shows the mean base quality by cycle.
This metric gives an overall snapshot of sequencing machine performance. For most types of sequencing data, the output is expected to show a slight reduction in overall base quality scores towards the end of each read.
Spikes in quality within reads are not expected and may indicate that technical problems occurred during sequencing.
Base Quality Distribution
Plot shows the count of each base quality score.
Samtools
1.16.1
HTSlib:
1.16
Toolkit for interacting with BAM/CRAM files.URL: http://www.htslib.orgDOI: 10.1093/bioinformatics/btp352
Percent mapped
Alignment metrics from samtools stats; mapped vs. unmapped reads vs. reads mapped with MQ0.
For a set of samples that have come from the same multiplexed library, similar numbers of reads for each sample are expected. Large differences in numbers might indicate issues during the library preparation process. Whilst large differences in read numbers may be controlled for in downstream processings (e.g. read count normalisation), you may wish to consider whether the read depths achieved have fallen below recommended levels depending on the applications.
Low alignment rates could indicate contamination of samples (e.g. adapter sequences), low sequencing quality or other artefacts. These can be further investigated in the sequence level QC (e.g. from FastQC).
Reads mapped with MQ0 often indicate that the reads are ambiguously mapped to multiple locations in the reference sequence. This can be due to repetitive regions in the genome, the presence of alternative contigs in the reference, or due to reads that are too short to be uniquely mapped. These reads are often filtered out in downstream analyses.
Alignment stats
This module parses the output from samtools stats. All numbers in millions.
Flagstat
This module parses the output from samtools flagstat
Mapped reads per contig
The samtools idxstats tool counts the number of mapped reads per chromosome / contig. Chromosomes with < 0.1% of the total aligned reads are omitted from this plot.
SnpEff
5.0e
Annotates and predicts the effects of variants on genes (such as amino acid changes).URL: http://snpeff.sourceforge.netDOI: 10.4161/fly.19695
Variants by Genomic Region
The stacked bar plot shows locations of detected variants in the genome and the number of variants for each location.
The upstream and downstream interval size to detect these genomic regions is 5000bp by default.
Variant Effects by Impact
The stacked bar plot shows the putative impact of detected variants and the number of variants for each impact.
There are four levels of impacts predicted by SnpEff:
- High: High impact (like stop codon)
- Moderate: Middle impact (like same type of amino acid substitution)
- Low: Low impact (ie silence mutation)
- Modifier: No impact
Variants by Effect Types
The stacked bar plot shows the effect of variants at protein level and the number of variants for each effect type.
This plot shows the effect of variants with respect to the mRNA.
Variants by Functional Class
The stacked bar plot shows the effect of variants and the number of variants for each effect type.
This plot shows the effect of variants on the translation of the mRNA as protein. There are three possible cases:
- Silent: The amino acid does not change.
- Missense: The amino acid is different.
- Nonsense: The variant generates a stop codon.
VARIANTS: QUAST
This section of the report shows QUAST QC results for the consensus sequence.URL: http://quast.bioinf.spbau.ruDOI: 10.1093/bioinformatics/btt086
Assembly Statistics
| Sample Name | N50 (Kbp) | L50 (K) | Largest contig (Kbp) | Length (Mbp) | Misassemblies | Mismatches/100kbp | Indels/100kbp | Genome Fraction |
|---|---|---|---|---|---|---|---|---|
| SAMPLE1_PE | 29.9Kbp | 0.0K | 29.9Kbp | 0.0Mbp | 0 | 20.45 | 0.00 | 98.1% |
| SAMPLE2_PE | 29.9Kbp | 0.0K | 29.9Kbp | 0.0Mbp | 0 | 22.34 | 0.00 | 89.8% |
| SAMPLE3_SE | 29.9Kbp | 0.0K | 29.9Kbp | 0.0Mbp | 0 | 6.86 | 0.00 | 97.4% |
Number of Contigs
This plot shows the number of contigs found for each assembly, broken down by length.
ASSEMBLY: QUAST (SPAdes)
This section of the report shows QUAST results from SPAdes de novo assembly.URL: http://quast.bioinf.spbau.ruDOI: 10.1093/bioinformatics/btt086
Assembly Statistics
| Sample Name | N50 (Kbp) | L50 (K) | Largest contig (Kbp) | Length (Mbp) | Misassemblies | Mismatches/100kbp | Indels/100kbp | Genome Fraction |
|---|---|---|---|---|---|---|---|---|
| SAMPLE1_PE | 21.0Kbp | 0.0K | 21.0Kbp | 0.0Mbp | 0 | 20.27 | 0.00 | 99.0% |
| SAMPLE2_PE | 4.1Kbp | 0.0K | 10.4Kbp | 0.0Mbp | 0 | 38.24 | 3.48 | 96.0% |
| SAMPLE3_SE | 8.8Kbp | 0.0K | 16.9Kbp | 0.0Mbp | 0 | 10.09 | 0.00 | 99.0% |
Number of Contigs
This plot shows the number of contigs found for each assembly, broken down by length.
Software Versions
Software Versions lists versions of software tools extracted from file contents.
| Group | Software | Version |
|---|---|---|
| Bcftools | Bcftools | 1.16 |
| Cutadapt | Cutadapt | 4.2 |
| FastQC | FastQC | 0.11.9 |
| Pangolin | Constellations | v0.1.10 |
| Pangolin | 4.2 | |
| Scorpio | 0.3.17 | |
| Samtools | HTSlib | 1.16 |
| Samtools | 1.16.1 | |
| SnpEff | SnpEff | 5.0e |
| fastp | fastp | 0.23.2 |